Product Information
- Product Type
- cDNA
- Antigen Species
- Human
- NCBI Accession No.
- NP_001119653.1
- Alternative names
- Neurogranin, NRGN, HNG, RC3
- RNA Reference Number
- NM_001126181.1
- OMIM Number
- 602350
- Chromosome Location
- 11q24
Product Specification
- Formulation
- Lyophilized
- Storage
- Store the plasmid at -20C.
- cDNA size
- 237bp
- Preparation before usage
- 1. Centrifuge at 7000rpm for 1 minute.
2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.
Each tube contains approximately 10ug of lyophilized plasmid.
- Vector description:
- This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
- General Description
- Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects.
Data
- Nucleotide Sequence:
ATGGACTGCTGCACCGAGAACGCCTGCTCCAAGCCGGACGACGACATTCTAGACATCCCGCTGGACGATCCCGGCGCCAACGCGGCCGCCGCCAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGCGGAAGAAGATAAAGAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGGTGGCCCGGGGAGGCGCGGGCGGCGGCCCCAGCGGAGACTAG - Translation Sequence:
MDCCTENACS KPDDDILDIP LDDPGANAAA AKIQASFRGH MARKKIKSGE RGRKGPGPGG PGGAGVARGG AGGGPSGD
Note: For research use only. This product is not intended or approved for human, diagnostics or veterinary use.